BACK

                          DNA and AMINO ACID SEQUENCES of HUMAN CBS
                                         
                                                                                                                  


   1  ATGCCTTCTGAGACCCCCCAGGCAGAAGTGGGGCCCACAGGCTGCCCCCACCGCTCAGGGCCACACTCGGCGAAGGGGAGCCTGGAGAAGGGGTCCCCAGAGGATAAGGAAGCCAAGGAG  120


   1   M  P  S  E  T  P  Q  A  E  V  G  P  T  G  C  P  H  R  S  G  P  H  S  A  K  G  S  L  E  K  G  S  P  E  D  K  E  A  K  E    40


                                                                                                                  


 121  CCCCTGTGGATCCGGCCCGATGCTCCGAGCAGGTGCACCTGGCAGCTGGGCCGGCCTGCCTCCGAGTCCCCACATCACCACACTGCCCCGGCAAAATCTCCAAAAATCTTGCCAGATATT  240


  41   P  L  W  I  R  P  D  A  P  S  R  C  T  W  Q  L  G  R  P  A  S  E  S  P  H  H  H  T  A  P  A  K  S  P  K  I  L  P  D  I    80


                                                                                                                  


 241  CTGAAGAAAATCGGGGACACCCCTATGGTCAGAATCAACAAGATTGGGAAGAAGTTCGGCCTGAAGTGTGAGCTCTTGGCCAAGTGTGAGTTCTTCAACGCGGGCGGGAGCGTGAAGGAC  360


  81   L  K  K  I  G  D  T  P  M  V  R  I  N  K  I  G  K  K  F  G  L  K  C  E  L  L  A  K  C  E  F  F  N  A  G  G  S  V  K  D   120


                                                                                                                  


 361  CGCATCAGCCTGCGGATGATTGAGGATGCTGAGCGCGACGGGACGCTGAAGCCCGGGGACACGATTATCGAGCCGACATCCGGGAACACCGGGATCGGGCTGGCCCTGGCTGCGGCAGTG  480


 121   R  I  S  L  R  M  I  E  D  A  E  R  D  G  T  L  K  P  G  D  T  I  I  E  P  T  S  G  N  T  G  I  G  L  A  L  A  A  A  V   160


                                                                                                                  


 481  AGGGGCTATCGCTGCATCATCGTGATGCCAGAGAAGATGAGCTCCGAGAAGGTGGACGTGCTGCGGGCACTGGGGGCTGAGATTGTGAGGACGCCCACCAATGCCAGGTTCGACTCCCCG  600


 161   R  G  Y  R  C  I  I  V  M  P  E  K  M  S  S  E  K  V  D  V  L  R  A  L  G  A  E  I  V  R  T  P  T  N  A  R  F  D  S  P   200


                                                                                                                  


 601  GAGTCACACGTGGGGGTGGCCTGGCGGCTGAAGAACGAAATCCCCAATTCTCACATCCTAGACCAGTACCGCAACGCCAGCAACCCCCTGGCTCACTACGACACCACCGCTGATGAGATC  720


 201   E  S  H  V  G  V  A  W  R  L  K  N  E  I  P  N  S  H  I  L  D  Q  Y  R  N  A  S  N  P  L  A  H  Y  D  T  T  A  D  E  I   240


                                                                                                                   


 721  CTGCAGCAGTGTGATGGGAAGCTGGACATGCTGGTGGCTTCAGTGGGCACGGGCGGCACCATCACGGGCATTGCCAGGAAGCTGAAGGAGAAGTGTCCTGGATGCAGGATCATTGGGGTG  840


 241   L  Q  Q  C  D  G  K  L  D  M  L  V  A  S  V  G  T  G  G  T  I  T  G  I  A  R  K  L  K  E  K  C  P  G  C  R  I  I  G  V   280


                                                                                                                   


 841  GATCCCGAAGGGTCCATCCTCGCAGAGCCGGAGGAGCTGAACCAGACGGAGCAGACAACCTACGAGGTGGAAGGGATCGGCTACGACTTCATCCCCACGGTGCTGGACAGGACGGTGGTG  960


 281   D  P  E  G  S  I  L  A  E  P  E  E  L  N  Q  T  E  Q  T  T  Y  E  V  E  G  I  G  Y  D  F  I  P  T  V  L  D  R  T  V  V   320


                                                                                                                   


 961  GACAAGTGGTTCAAGAGCAACGATGAGGAGGCGTTCACCTTTGCCCGCATGCTGATCGCGCAAGAGGGGCTGCTGTGCGGTGGCAGTGCTGGCAGCACGGTGGCGGTGGCCGTGAAGGCT 1080


 321   D  K  W  F  K  S  N  D  E  E  A  F  T  F  A  R  M  L  I  A  Q  E  G  L  L  C  G  G  S  A  G  S  T  V  A  V  A  V  K  A   360


                                                                                                                   


1081  GCGCAGGAGCTGCAGGAGGGCCAGCGCTGCGTGGTCATTCTGCCCGACTCAGTGCGGAACTACATGACCAAGTTCCTGAGCGACAGGTGGATGCTGCAGAAGGGCTTTCTGAAGGAGGAG 1200


 361   A  Q  E  L  Q  E  G  Q  R  C  V  V  I  L  P  D  S  V  R  N  Y  M  T  K  F  L  S  D  R  W  M  L  Q  K  G  F  L  K  E  E   400


                                                                                                                   


1201  GACCTCACGGAGAAGAAGCCCTGGTGGTGGCACCTCCGTGTTCAGGAGCTGGGCCTGTCAGCCCCGCTGACCGTGCTCCCGACCATCACCTGTGGGCACACCATCGAGATCCTCCGGGAG 1320


 401   D  L  T  E  K  K  P  W  W  W  H  L  R  V  Q  E  L  G  L  S  A  P  L  T  V  L  P  T  I  T  C  G  H  T  I  E  I  L  R  E   440


                                                                                                                   


1321  AGGGCTTCGACCAGGCGCCCGTGGTGGATGAGGCGGGGGTAATCCTGGGAATGGTGACGCTTGGGAACATGCTCTCGTCCCTGCTTGCCGGGAAGGTGCAGCCGTCAGACCAAGTTGGC 1440


 441   K  G  F  D  Q  A  P  V  V  D  E  A  G  V  I  L  G  M  V  T  L  G  N  M  L  S  S  L  L  A  G  K  V  Q  P  S  D  Q  V  G   480


                                                                                                                   


1441  AAAGTCATCTACAAGCAGTTCAAACAGATCCGCCTCACGGACACGCTGGGCAGGCTCTCGCACATCCTGGAGATGGACCACTTCGCCCTGGTGGTGCACGAGCAGATCCAGTACCACAGC 1560


 481   K  V  I  Y  K  Q  F  K  Q  I  R  L  T  D  T  L  G  R  L  S  H  I  L  E  M  D  H  F  A  L  V  V  H  E  Q  I  Q  Y  H  S   520


                                                                                                                  


1561  ACCGGGAAGTCCAGTCAGCGGCAGATGGTGTTCGGGGTGGTCACCGCCATTGACTTGCTGAACTTCGTGGCCGCCCAGGAGCGGGACCAGAAGTGAAGTCCGGAGCGCTGGGCGGATGTT 1680


 521   T  G  K  S  S  Q  R  Q  M  V  F  G  V  V  T  A  I  D  L  L  N  F  V  A  A  Q  E  R  D  Q  K  *                           551